Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circ_000926 | |||
Gene | Organism | Human | |
Genome Locus | Build | hg19 | |
Disease | Pancreatic Cancer | ICD-10 | Malignant neoplasm of Pancreas, unspecified (C25.9) |
DBLink | PMID | 29781033 | |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | The PC cell line, SW1990 |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TTGTGCTTTCTGGAGGGTCT ReverseGCACAAATAAACCCCACATTTT | Statistics | Fold Change : Downregulated pvalue : <0.05 |
Citation | |||
Xu, C, Yu, Y, Ding, F (2018). Microarray analysis of circular RNA expression profiles associated with gemcitabine resistance in pancreatic cancer cells. Oncol. Rep., 40, 1:395-404. |